Publicación: Propuesta de implementación de la técnica RT-qPCR para la detección molecular temprana del virus dengue en el Laboratorio Referencial de Salud Pública – DIRESA Junín
| dc.contributor.advisor | Castillo Pareja, Denis Helan | es_ES |
| dc.contributor.author | Severo Romero, David Eduardo | es_ES |
| dc.date.accessioned | 2022-02-07T20:55:50Z | |
| dc.date.available | 2022-02-07T20:55:50Z | |
| dc.date.issued | 2022 | |
| dc.description.abstract | El dengue es una enfermedad producida por el virus del dengue. En la actualidad existen diversas técnicas que son utilizadas para su diagnóstico, sin embargo, la RT-qPCR permite obtener resultados confiables y rápidos con una alta sensibilidad y especificidad. Además, a diferencia de la prueba ELISA NS1, nos permite identificar los serotipos del DENV. El objetivo del presente Trabajo de Suficiencia Profesional fue diseñar una propuesta para la implementación de la técnica RT-qPCR para la detección molecular temprana del DENV y sus serotipos en el Laboratorio Referencial de Salud Pública – DIRESA JUNÍN. Se revisó la bibliografía disponible sobre los primers y las sondas que están siendo utilizados para el diagnóstico del DENV y sus serotipos. Estas secuencias fueron evaluadas mediante la herramienta “Nucleotide-BLAST” y en base a los resultados obtenidos se propusieron los primers forward GATTTAGCAACATTCTRGATGTCAT GTT, reverse TTGCACCAACAGTCAATGTCTTCAGGTTC y forward AGAGCAGA TCTCTGATGAATAACCAA, reverse TTGCACCAACAGTCAATGTCTTCAGGTTC para su uso en el diagnóstico de los serotipos DENV-1 y DENV-2 respectivamente. Se elaboró el protocolo para la estandarización de la técnica RT-qPCR y las condiciones mínimas para su operación fueron elaboradas en base a la infraestructura y equipos disponibles en el laboratorio. Los pasos para desarrollar cada actividad se establecieron en los protocolos de recepción de muestras, alicuotado, extracción de ARN viral y RT-qPCR. Finalmente se compararon los resultados de las pruebas ELISA NS1 procesadas en el Laboratorio referencial y los resultados de la RT-qPCR reportados en el sistema NETLAB durante el periodo comprendido entre septiembre 2018 y agosto 2021. Los resultados de la RT-qPCR han demostrado tener mayor sensibilidad y especificidad en comparación de los resultados de la técnica de ELISA NS1. Estos hallazgos demostraron la importancia de la implementación de la RT-qPCR como herramienta de diagnóstico molecular del DENV y sus serotipos en el Laboratorio Referencial de Salud Pública – DIRESA JUNÍN. | es_ES |
| dc.description.abstract | Dengue fever is a disease caused by the dengue virus (DENV). In actuality there are several techniques that are used for its diagnosis. The RT-qPCR test enables reliable results with high sensitivity and specificity, moreover unlike the ELISA NS1 test, it allows us to identify the serotypes od DENV. The objective of the current work was to design a proposal for the implementation of the RT-qPCR for their use as an early molecular detection test of DENV and its serotypes in the Public Health Reference Laboratory – DIRESA JUNÍN. The available bibliography on the primers and probes that are being used for the diagnosis and identification of DENV and its serotypes was reviewed. These sequences were evaluated using the “Nucleotide-BLAST” tool and based on the results the primer sequences forward GATTTAGCAACATTCTRGATGTCATGTT, reverse TTGCACCA ACAGTCAATGTCTTCAGGTTC and forward AGAGCAGATCTCTGATGAATAAC CAA, reverse TGCACCAACAGTCAATGTCTTCAGGTTC were proposed for the diagnosis of DENV-1 and DENV-2 respectively. The protocol for the standardization of the RT-qPCR test and the minimum conditions for its operation was elaborated and based of the infrastructure and equipment available in the laboratory. The steps to perform each activity were established in the protocols for receiving samples, aliquoting samples, extraction of viral RNA and the RT-qPCR test. Finally, a comparison was made between the results of the ELISA NS1 processed in the Reference Laboratory and the results of the RT-qPCR test reported un the NETLAB system during the period between September 2018 and August 2021. The results of the RT-qPCR have been shown to have higher sensitivity and specificity compared to the results of the ELISA NS1 test. These findings demonstrated the importance of the implementation of the RT-qPCR test as a molecular diagnostic tool for DENV and its serotypes in the Public Health Reference Laboratory – DIRESA JUNÍN. | es_ES |
| dc.format | application/pdf | es_ES |
| dc.identifier.other | 207870 | es_ES |
| dc.identifier.uri | https://hdl.handle.net/20.500.12866/11352 | |
| dc.language.iso | spa | es_ES |
| dc.publisher | Universidad Peruana Cayetano Heredia | es_ES |
| dc.publisher.country | PE | es_ES |
| dc.rights | https://purl.org/coar/access_right/c_abf2 | es_ES |
| dc.rights.uri | https://creativecommons.org/licenses/by-nc-nd/4.0/deed.es | es_ES |
| dc.subject | Virus del Dengue | es_ES |
| dc.subject | RT-qPCR | es_ES |
| dc.subject | Control de Calidad | es_ES |
| dc.subject.ocde | https://purl.org/pe-repo/ocde/ford#1.06.01 | es_ES |
| dc.subject.ocde | https://purl.org/pe-repo/ocde/ford#1.06.02 | es_ES |
| dc.subject.ocde | https://purl.org/pe-repo/ocde/ford#2.06.02 | es_ES |
| dc.subject.ocde | https://purl.org/pe-repo/ocde/ford#3.03.08 | es_ES |
| dc.title | Propuesta de implementación de la técnica RT-qPCR para la detección molecular temprana del virus dengue en el Laboratorio Referencial de Salud Pública – DIRESA Junín | es_ES |
| dc.type | http://purl.org/coar/resource_type/c_7a1f | es_ES |
| dspace.entity.type | Publication | |
| renati.advisor.dni | 40219259 | |
| renati.advisor.orcid | https://orcid.org/0000-0003-1010-2353 | es_ES |
| renati.author.dni | 47186517 | |
| renati.discipline | 511206 | es_ES |
| renati.juror | López Campana, Mariano Giovanni | es_ES |
| renati.juror | Talledo Albújar, Michael John | es_ES |
| renati.level | https://purl.org/pe-repo/renati/level#tituloProfesional | es_ES |
| renati.type | https://purl.org/pe-repo/renati/type#trabajoDeSuficienciaProfesional | es_ES |
| thesis.degree.discipline | Biología | es_ES |
| thesis.degree.grantor | Universidad Peruana Cayetano Heredia. Facultad de Ciencias y Filosofía Alberto Cazorla Talleri | es_ES |
| thesis.degree.name | Licenciado en Biología | es_ES |
