Universidad Peruana Cayetano Heredia

Propuesta de implementación de la técnica RT-qPCR para la detección molecular temprana del virus dengue en el Laboratorio Referencial de Salud Pública – DIRESA Junín

Mostrar el registro sencillo del ítem

dc.contributor.advisor Castillo Pareja, Denis Helan es_ES
dc.contributor.author Severo Romero, David Eduardo es_ES
dc.date.accessioned 2022-02-07T20:55:50Z
dc.date.available 2022-02-07T20:55:50Z
dc.date.issued 2022
dc.identifier.other 207870 es_ES
dc.identifier.uri https://hdl.handle.net/20.500.12866/11352
dc.description.abstract El dengue es una enfermedad producida por el virus del dengue. En la actualidad existen diversas técnicas que son utilizadas para su diagnóstico, sin embargo, la RT-qPCR permite obtener resultados confiables y rápidos con una alta sensibilidad y especificidad. Además, a diferencia de la prueba ELISA NS1, nos permite identificar los serotipos del DENV. El objetivo del presente Trabajo de Suficiencia Profesional fue diseñar una propuesta para la implementación de la técnica RT-qPCR para la detección molecular temprana del DENV y sus serotipos en el Laboratorio Referencial de Salud Pública – DIRESA JUNÍN. Se revisó la bibliografía disponible sobre los primers y las sondas que están siendo utilizados para el diagnóstico del DENV y sus serotipos. Estas secuencias fueron evaluadas mediante la herramienta “Nucleotide-BLAST” y en base a los resultados obtenidos se propusieron los primers forward GATTTAGCAACATTCTRGATGTCAT GTT, reverse TTGCACCAACAGTCAATGTCTTCAGGTTC y forward AGAGCAGA TCTCTGATGAATAACCAA, reverse TTGCACCAACAGTCAATGTCTTCAGGTTC para su uso en el diagnóstico de los serotipos DENV-1 y DENV-2 respectivamente. Se elaboró el protocolo para la estandarización de la técnica RT-qPCR y las condiciones mínimas para su operación fueron elaboradas en base a la infraestructura y equipos disponibles en el laboratorio. Los pasos para desarrollar cada actividad se establecieron en los protocolos de recepción de muestras, alicuotado, extracción de ARN viral y RT-qPCR. Finalmente se compararon los resultados de las pruebas ELISA NS1 procesadas en el Laboratorio referencial y los resultados de la RT-qPCR reportados en el sistema NETLAB durante el periodo comprendido entre septiembre 2018 y agosto 2021. Los resultados de la RT-qPCR han demostrado tener mayor sensibilidad y especificidad en comparación de los resultados de la técnica de ELISA NS1. Estos hallazgos demostraron la importancia de la implementación de la RT-qPCR como herramienta de diagnóstico molecular del DENV y sus serotipos en el Laboratorio Referencial de Salud Pública – DIRESA JUNÍN. es_ES
dc.description.abstract Dengue fever is a disease caused by the dengue virus (DENV). In actuality there are several techniques that are used for its diagnosis. The RT-qPCR test enables reliable results with high sensitivity and specificity, moreover unlike the ELISA NS1 test, it allows us to identify the serotypes od DENV. The objective of the current work was to design a proposal for the implementation of the RT-qPCR for their use as an early molecular detection test of DENV and its serotypes in the Public Health Reference Laboratory – DIRESA JUNÍN. The available bibliography on the primers and probes that are being used for the diagnosis and identification of DENV and its serotypes was reviewed. These sequences were evaluated using the “Nucleotide-BLAST” tool and based on the results the primer sequences forward GATTTAGCAACATTCTRGATGTCATGTT, reverse TTGCACCA ACAGTCAATGTCTTCAGGTTC and forward AGAGCAGATCTCTGATGAATAAC CAA, reverse TGCACCAACAGTCAATGTCTTCAGGTTC were proposed for the diagnosis of DENV-1 and DENV-2 respectively. The protocol for the standardization of the RT-qPCR test and the minimum conditions for its operation was elaborated and based of the infrastructure and equipment available in the laboratory. The steps to perform each activity were established in the protocols for receiving samples, aliquoting samples, extraction of viral RNA and the RT-qPCR test. Finally, a comparison was made between the results of the ELISA NS1 processed in the Reference Laboratory and the results of the RT-qPCR test reported un the NETLAB system during the period between September 2018 and August 2021. The results of the RT-qPCR have been shown to have higher sensitivity and specificity compared to the results of the ELISA NS1 test. These findings demonstrated the importance of the implementation of the RT-qPCR test as a molecular diagnostic tool for DENV and its serotypes in the Public Health Reference Laboratory – DIRESA JUNÍN. es_ES
dc.format application/pdf es_ES
dc.language.iso spa es_ES
dc.publisher Universidad Peruana Cayetano Heredia es_ES
dc.rights info:eu-repo/semantics/openAccess es_ES
dc.rights.uri https://creativecommons.org/licenses/by-nc-nd/4.0/deed.es es_ES
dc.subject Virus del Dengue es_ES
dc.subject RT-qPCR es_ES
dc.subject Control de Calidad es_ES
dc.title Propuesta de implementación de la técnica RT-qPCR para la detección molecular temprana del virus dengue en el Laboratorio Referencial de Salud Pública – DIRESA Junín es_ES
dc.type info:eu-repo/semantics/bachelorThesis es_ES
thesis.degree.name Licenciado en Biología es_ES
thesis.degree.grantor Universidad Peruana Cayetano Heredia. Facultad de Ciencias y Filosofía Alberto Cazorla Talleri es_ES
thesis.degree.discipline Biología es_ES
dc.publisher.country PE es_ES
dc.subject.ocde http://purl.org/pe-repo/ocde/ford#1.06.01 es_ES
dc.subject.ocde http://purl.org/pe-repo/ocde/ford#1.06.02 es_ES
dc.subject.ocde http://purl.org/pe-repo/ocde/ford#2.06.02 es_ES
dc.subject.ocde http://purl.org/pe-repo/ocde/ford#3.03.08 es_ES
renati.author.dni 47186517
renati.advisor.orcid https://orcid.org/0000-0003-1010-2353 es_ES
renati.advisor.dni 40219259
renati.type http://purl.org/pe-repo/renati/type#trabajoDeSuficienciaProfesional es_ES
renati.level http://purl.org/pe-repo/renati/nivel#tituloProfesional es_ES
renati.discipline 511206 es_ES
renati.juror López Campana, Mariano Giovanni es_ES
renati.juror Talledo Albújar, Michael John es_ES


Ficheros en el ítem

Este ítem aparece en la(s) siguiente(s) colección(ones)

Mostrar el registro sencillo del ítem

info:eu-repo/semantics/openAccess Excepto si se señala otra cosa, la licencia del ítem se describe como info:eu-repo/semantics/openAccess

Buscar en el Repositorio


Listar

Panel de Control

Estadísticas